Skip to main content

pIHEU-MCS
(Plasmid #58375)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58375 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pAPIC
  • Modifications to backbone
    contains 5xUAS-Hsp70-Intron-MCS (9863 bp) cloned into SphI/XhaI sites.
  • Vector type
    Insect Expression
  • Selectable markers
    mini-white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer aattgtgctcggcaacagc
  • 3′ sequencing primer ggcgcacagaaatgattacaac
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pIHEU-MCS was a gift from Chun Han (Addgene plasmid # 58375 ; http://n2t.net/addgene:58375 ; RRID:Addgene_58375)
  • For your References section:

    Phosphatidylserine Externalization Results from and Causes Neurite Degeneration in Drosophila. Sapar ML, Ji H, Wang B, Poe AR, Dubey K, Ren X, Ni JQ, Han C. Cell Rep. 2018 Aug 28;24(9):2273-2286. doi: 10.1016/j.celrep.2018.07.095. 10.1016/j.celrep.2018.07.095 PubMed 30157423