Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pDC-UAS-nBitbow1.0(miniW)
(Plasmid #138329)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 138329 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDC-MUH
  • Backbone manufacturer
    Cai Lab
  • Backbone size w/o insert (bp) 6564
  • Total vector size (bp) 20247
  • Modifications to backbone
    pDC-MUH is modified from pJFRC-MUH (Addgene#26213). Original restriction sites flanking the two 5xUAS sequences are modified. SV40pA is replaced by p10pA.
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    mAmetrine
  • Promoter 10xUAS
  • Tag / Fusion Protein
    • human H2B (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTGCTCGTTGGGGTCTTTGAACAGCTTGCT
  • 3′ sequencing primer CACCCTGTCTTACGGCGTGCAGTGCTTCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tdKatushka2
  • Promoter 10xUAS
  • Tag / Fusion Protein
    • human H2B (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GGTGCCATGCCCGCTGTG
  • 3′ sequencing primer CCTCCTCCGAGGACAACAACATGGCCATGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    mNeonGreen
  • Promoter 10xUAS
  • Tag / Fusion Protein
    • human H2B (N terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGTGCTCCGGTAGCGCTTGCCATTT
  • 3′ sequencing primer CGGCTACCAAGTCCATCGCACAAT
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    mTFP1
  • Promoter 10xUAS
  • Tag / Fusion Protein
    • human H2B (N terminal on insert)

Cloning Information for Gene/Insert 4

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AGGCGAACGCGGTGGTCAGAATGT
  • 3′ sequencing primer ACCACAATGGGCGTAATCAAGCCCGACATG
  • (Common Sequencing Primers)

Gene/Insert 5

  • Gene/Insert name
    mKusabira-Orange2
  • Promoter 10xUAS
  • Tag / Fusion Protein
    • human H2B (N terminal on insert)

Cloning Information for Gene/Insert 5

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTTGTAAGTAGTCTTCATTTGGCATTTGTGATT
  • 3′ sequencing primer GTGTCCCACGTGTTCTGTTACGGCCACAGAGTTTTTACC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDC-UAS-nBitbow1.0(miniW) was a gift from Dawen Cai (Addgene plasmid # 138329 ; http://n2t.net/addgene:138329 ; RRID:Addgene_138329)
  • For your References section:

    Identification of Neuronal Lineages in the Drosophila Peripheral Nervous System with a "Digital" Multi-spectral Lineage Tracing System. Veling MW, Li Y, Veling MT, Litts C, Michki N, Liu H, Ye B, Cai D. Cell Rep. 2019 Dec 3;29(10):3303-3312.e3. doi: 10.1016/j.celrep.2019.10.124. 10.1016/j.celrep.2019.10.124 PubMed 31801091