pCas12f1
(Plasmid #171182)

• Purpose: Constitutive expression of cas12f1, arabinose-inducible expression of lambda recombinase, and IPTG-inducible expression of sgRNA for curing of pTarget12f1
• Depositing Lab: Kohsuke Honda
• Publication: Okano et al J Biosci Bioeng. 2021 Aug;132(2):120-124. doi: 10.1016/j.jbiosc.2021.04.009. Epub 2021 May 19.

Backbone

• Vector backbone: pCas
• Backbone size w/o insert (bp): 8576
• Total vector size (bp): 12545
• Modifications to backbone: sgRNA sequence for targeting pTargetF was replaced with the one for targeting pTarget12f1.
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): DH5alpha
• Growth instructions: Must be grown at 30C. Vector has temperature-sensitive replication (RepA101ts)
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cas12f1
• Alt name: Cas14a1
• Alt name: Un1Cas12f1
• Species: Synthetic
• Insert Size (bp): 1587
• Promoter: cas9 promoter from Streptococcus pyogenes

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SalI/XhoI (destroyed during cloning)
• 3′ cloning site: KpnI (not destroyed)
• 5′ sequencing primer: GTATTGGGTAATATTTTTTGAAGAGATATTTTG
• 3′ sequencing primer: CATTCAAATATGTATCCGCTCATG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry