Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCas12f1
(Plasmid #171182)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171182 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCas
  • Backbone size w/o insert (bp) 8576
  • Total vector size (bp) 12545
  • Modifications to backbone
    sgRNA sequence for targeting pTargetF was replaced with the one for targeting pTarget12f1.
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Must be grown at 30C. Vector has temperature-sensitive replication (RepA101ts)
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas12f1
  • Alt name
    Cas14a1
  • Species
    Synthetic
  • Insert Size (bp)
    1587
  • Promoter cas9 promoter from Streptococcus pyogenes

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI/XhoI (destroyed during cloning)
  • 3′ cloning site KpnI (not destroyed)
  • 5′ sequencing primer GTATTGGGTAATATTTTTTGAAGAGATATTTTG
  • 3′ sequencing primer CATTCAAATATGTATCCGCTCATG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCas12f1 was a gift from Kohsuke Honda (Addgene plasmid # 171182 ; http://n2t.net/addgene:171182 ; RRID:Addgene_171182)
  • For your References section:

    Genome editing by miniature CRISPR/Cas12f1 enzyme in Escherichia coli. Okano K, Sato Y, Hizume T, Honda K. J Biosci Bioeng. 2021 Aug;132(2):120-124. doi: 10.1016/j.jbiosc.2021.04.009. Epub 2021 May 19. 10.1016/j.jbiosc.2021.04.009 PubMed 34023220