pCas12f1
(Plasmid
#171182)
-
PurposeConstitutive expression of cas12f1, arabinose-inducible expression of lambda recombinase, and IPTG-inducible expression of sgRNA for curing of pTarget12f1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 171182 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCas
- Backbone size w/o insert (bp) 8576
- Total vector size (bp) 12545
-
Modifications to backbonesgRNA sequence for targeting pTargetF was replaced with the one for targeting pTarget12f1.
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMust be grown at 30C. Vector has temperature-sensitive replication (RepA101ts)
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas12f1
-
Alt nameCas14a1
-
Alt nameUn1Cas12f1
-
SpeciesSynthetic
-
Insert Size (bp)1587
- Promoter cas9 promoter from Streptococcus pyogenes
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI/XhoI (destroyed during cloning)
- 3′ cloning site KpnI (not destroyed)
- 5′ sequencing primer GTATTGGGTAATATTTTTTGAAGAGATATTTTG
- 3′ sequencing primer CATTCAAATATGTATCCGCTCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCas12f1 was a gift from Kohsuke Honda (Addgene plasmid # 171182 ; http://n2t.net/addgene:171182 ; RRID:Addgene_171182) -
For your References section:
Genome editing by miniature CRISPR/Cas12f1 enzyme in Escherichia coli. Okano K, Sato Y, Hizume T, Honda K. J Biosci Bioeng. 2021 Aug;132(2):120-124. doi: 10.1016/j.jbiosc.2021.04.009. Epub 2021 May 19. 10.1016/j.jbiosc.2021.04.009 PubMed 34023220