- 
            PurposeMammalian expression of tagRFP targeted to the mitochondrial matrix
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepclbw
- 
              Backbone manufacturergifted by C. Lois and D. Baltimore
- 
              Vector typeMammalian Expression, Retroviral
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberUnknown
Gene/Insert
- 
                Gene/Insert namemito-tagRFP
- 
                  Alt namecox8-tagRFP
- Promoter cmv-bactin
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer TCTGCTAACCATGTTCATGCC
- 3′ sequencing primer AGCAGCGTATCCACATAGC (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made bygene gifted from R.Tsien
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pclbw-mitoTagRFP was a gift from David Chan (Addgene plasmid # 58425 ; http://n2t.net/addgene:58425 ; RRID:Addgene_58425)
- 
                For your References section: Proteolytic cleavage of Opa1 stimulates mitochondrial inner membrane fusion and couples fusion to oxidative phosphorylation. Mishra P, Carelli V, Manfredi G, Chan DC. Cell Metab. 2014 Apr 1;19(4):630-41. doi: 10.1016/j.cmet.2014.03.011. 10.1016/j.cmet.2014.03.011 PubMed 24703695
