VV201: ChR2(C128S)-eGFP in fubi
(Plasmid
#58510)
-
PurposeExpresses channelrhodopsin-2 with the C128S (step function opsin) mutation fused to eGFP under the ubiquitin promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneFUGW (from Addgene plasmid 22051)
-
Backbone manufacturerAddgene plasmid 22051
- Backbone size w/o insert (bp) 9200
- Total vector size (bp) 10700
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameChR2(C128S)-eGFP
-
Alt nameChannelrhodopsin-2
-
SpeciesC. reinhardtii
-
Insert Size (bp)1662
-
MutationChanged Cysteine 128 to Serine
-
GenBank ID
- Promoter Ubiquitin
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer tcttcttaagtagctgaagctccg
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe received this gene (ChR2) from the Boyden Lab at MIT; we made the C128S point mutation in ChR2. Note that this point mutation was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see Addgene plasmid 20294 (pLenti-CaMKIIa-hChR2(C128S)-EYFP-WPRE) for the original version of this gene (under the CamKII promoter).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV201: ChR2(C128S)-eGFP in fubi was a gift from Adam Cohen (Addgene plasmid # 58510 ; http://n2t.net/addgene:58510 ; RRID:Addgene_58510) -
For your References section:
Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307