-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 27054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 6290
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsPlease use Rec A- competent cells such as Stbl3 cells from Invitrogen for transformation.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehChR2(H134R)
-
Alt nameChR2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1662
-
MutationH134R
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI, SalI (not destroyed)
- 3′ cloning site EcoRI, HinDIII (not destroyed)
- 5′ sequencing primer ccaaccccaccccctcaggctatg
- 3′ sequencing primer GCAATAGCATGATACAAAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains the human GFAP promoter.
For additional information please visit - http://www.optogenetics.org
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFAP-hChR2(H134R)-EYFP was a gift from Karl Deisseroth (Addgene plasmid # 27054 ; http://n2t.net/addgene:27054 ; RRID:Addgene_27054)