VV229: GCaMP6f in fck
(Plasmid #58514)

• Purpose: Expresses GCaMP6f under the a-CamKII promoter
• Depositing Lab: Adam Cohen
• Publication: Venkatachalam et al Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020.

Backbone

• Vector backbone: FCK(1.3)GW, from Addgene 22217
• Backbone size w/o insert (bp): 9240
• Total vector size (bp): 10059
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: Use recombinase-free E. coli.
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: GCaMP6f
• Alt name: GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
• Species: R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
• Insert Size (bp): 1380
• GenBank ID:
• Promoter: a-CamKII
• Tag / Fusion Protein:
  • C-terminal FCYENEV (ER export motif); this was not deliberately added, but doesn't seem to hurt

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: GCTCGTCAATCAAGCTGGTTC
• 3′ sequencing primer: CCACATAGCGTAAAAGGAGCAAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The calcium sensor GCaMP6f (see Addgene plasmid 40755) was obtained from Loren Looger and Douglas Kim.
• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please see Addgene plasmid 40755 for more information on GCaMP6f; also note that GCaMP6f was published in: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354.)