-
PurposeExpresses GCaMP6f under the a-CamKII promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58514 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCK(1.3)GW, from Addgene 22217
- Backbone size w/o insert (bp) 9240
- Total vector size (bp) 10059
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP6f
-
Alt nameGCaMP3-T302L R303P A317E D380Y T381R S383T R392G
-
SpeciesR. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
-
Insert Size (bp)1380
-
GenBank ID
- Promoter a-CamKII
-
Tag
/ Fusion Protein
- C-terminal FCYENEV (ER export motif); this was not deliberately added, but doesn't seem to hurt
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The calcium sensor GCaMP6f (see Addgene plasmid 40755) was obtained from Loren Looger and Douglas Kim.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please see Addgene plasmid 40755 for more information on GCaMP6f; also note that GCaMP6f was published in: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354.)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV229: GCaMP6f in fck was a gift from Adam Cohen (Addgene plasmid # 58514 ; http://n2t.net/addgene:58514 ; RRID:Addgene_58514) -
For your References section:
Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307