Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

VV229: GCaMP6f in fck
(Plasmid #58514)


Item Catalog # Description Quantity Price (USD)
Plasmid 58514 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    FCK(1.3)GW, from Addgene 22217
  • Backbone size w/o insert (bp) 9240
  • Total vector size (bp) 10059
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli.
  • Copy number


  • Gene/Insert name
  • Alt name
    GCaMP3-T302L R303P A317E D380Y T381R S383T R392G
  • Species
    R. norvegicus (rat), G. gallus (chicken); A. victoria (jellyfish)
  • Insert Size (bp)
  • GenBank ID
  • Promoter a-CamKII
  • Tag / Fusion Protein
    • C-terminal FCYENEV (ER export motif); this was not deliberately added, but doesn't seem to hurt

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
  • 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone of this plasmid was derived from Addgene plasmid 22217 (from the Boyden Lab at MIT), cut with BamHI and EcoRI. The calcium sensor GCaMP6f (see Addgene plasmid 40755) was obtained from Loren Looger and Douglas Kim.
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

Please see Addgene plasmid 40755 for more information on GCaMP6f; also note that GCaMP6f was published in: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354.)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV229: GCaMP6f in fck was a gift from Adam Cohen (Addgene plasmid # 58514 ; ; RRID:Addgene_58514)
  • For your References section:

    Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307