Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pJMK077: CaMKIIa QuasAr2-TS-GCaMP6f
(Plasmid #72304)


Item Catalog # Description Quantity Price (USD)
Plasmid 72304 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Pavel Osten
  • Backbone size w/o insert (bp) 9235
  • Total vector size (bp) 11528
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
  • Alt name
    QuasAr2 + GCaMP6f
  • Species
  • Insert Size (bp)
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • TS (C terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcctctttgccccacttaat
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJMK077: CaMKIIa QuasAr2-TS-GCaMP6f was a gift from Adam Cohen (Addgene plasmid # 72304 ; ; RRID:Addgene_72304)
  • For your References section:

    Cardiotoxicity screening with simultaneous optogenetic pacing, voltage imaging and calcium imaging. Dempsey GT, Chaudhary KW, Atwater N, Nguyen C, Brown BS, McNeish JD, Cohen AE, Kralj JM. J Pharmacol Toxicol Methods. 2016 May 13. pii: S1056-8719(16)30044-2. doi: 10.1016/j.vascn.2016.05.003. 10.1016/j.vascn.2016.05.003 PubMed 27184445