VV209: sdChR(C138S E154A)-TS-GCaMP6f-ER in fck
(Plasmid
#58524)
-
PurposeExpresses sdChR(C138S E154A) fused to GCaMP6f in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCK(1.3)GW, from Addgene 22217
- Backbone size w/o insert (bp) 9240
- Total vector size (bp) 10059
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesdChR(C138S, E154A)-TS-GCaMP6f-ER
-
Alt nameChannelrhodopsin from Scherffelia dubia
-
SpeciesScherffelia dubia
-
Insert Size (bp)2420
-
Mutationchanged Cysteine 138 to Serine; changed Glutamate 154 to Alanine
- Promoter a-CamKII
-
Tag
/ Fusion Protein
- GCaMP6f (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer GCTCGTCAATCAAGCTGGTTC
- 3′ sequencing primer CCACATAGCGTAAAAGGAGCAAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe originally received this gene (sdChR) from Nathan Klapoetke in the Boyden Lab at MIT; the protein engineering leading to introduction of the E154A mutation is described in: Hochbaum, Zhao, Farhi, Klapoetke, et al. 2014. "All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins." Nature Methods (in press). We made the C138S point mutation in sdChR(E154A). Note that C138 in sdChR is homologous to C128 in ChR2; the ChR2(C128S) point mutant was first made by Berndt et al (reference: Bi-stable neural state switches. Berndt et al (Nat Neurosci. 2009 Feb. 12(2):229-34.) The calcium sensor GCaMP6f (see Addgene plasmid 40755) was obtained from Loren Looger and Douglas Kim.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
sdChR was first published in: Klapoetke, N. C., Y. Murata, S.S. Kim, S.R. Pulver, A. Birdsey-Benson, Y.K. Cho, T.K. Morimoto, A.S. Chuong, E.J. Carpenter and Z. Tian. 2014. Independent optical excitation of distinct neural populations. Nat. Meth. 11, 338-346.
sdChR(E154A) was first published in: Hochbaum, Zhao, Farhi, Klapoetke, et al. 2014. "All-optical electrophysiology in mammalian neurons using engineered microbial rhodopsins." Nature Methods (in press).
GCaMP6f was published in: Ultrasensitive fluorescent proteins for imaging neuronal activity. Chen et al (Nature. 2013 Jul 18;499(7458):295-300. doi: 10.1038/nature12354.)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
VV209: sdChR(C138S E154A)-TS-GCaMP6f-ER in fck was a gift from Adam Cohen (Addgene plasmid # 58524 ; http://n2t.net/addgene:58524 ; RRID:Addgene_58524) -
For your References section:
Imaging GFP-Based Reporters in Neurons with Multiwavelength Optogenetic Control. Venkatachalam V, Cohen AE. Biophys J. 2014 Oct 7;107(7):1554-63. doi: 10.1016/j.bpj.2014.08.020. 10.1016/j.bpj.2014.08.020 PubMed 25296307