Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


dTomato_LD 0_CS G_tTA-BFP
(Plasmid #58871)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58871 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Backbone size w/o insert (bp) 5520
  • Total vector size (bp) 8151
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
    MESA target chain with dTomato ectodomain, cd28 transmembrane domain, wild type TEV cleavage sequence
  • Species
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • EBFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ATGTGCCGAGCCATCTCTCT
  • 3′ sequencing primer TTACTTGTACAGCTCGTCCA
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dTomato_LD 0_CS G_tTA-BFP was a gift from Joshua Leonard (Addgene plasmid # 58871 ; ; RRID:Addgene_58871)
  • For your References section:

    Modular Extracellular Sensor Architecture for Engineering Mammalian Cell-based Devices. Daringer NM, Dudek RM, Schwarz KA, Leonard JN. ACS Synth Biol. 2014 Mar 11. 10.1021/sb400128g PubMed 24611683