-
PurposeExpresses SECFP-hATG16A1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58994 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepMRXIP GFP-Ci2
-
Backbone manufacturerDr.Shoji Yamaoka of Tokyo Medical and Dental University
- Backbone size w/o insert (bp) 6600
-
Vector typeRetroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomo sapiens autophagy related 16-like 1 (S. cerevisiae)
-
Alt nameATG16L1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1765
-
GenBank IDNM_017974
-
Entrez GeneATG16L1 (a.k.a. APG16L, ATG16A, ATG16L, IBD10, WDR30)
-
Tag
/ Fusion Protein
- SECFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGACCACTACCAGCAGAACA
- 3′ sequencing primer AAAAGACGGCAATATGGTGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byIt has the pMX backbone
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRX-IP/SECFP-hATG16A1 was a gift from Noboru Mizushima (Addgene plasmid # 58994 ; http://n2t.net/addgene:58994 ; RRID:Addgene_58994) -
For your References section:
Temporal analysis of recruitment of mammalian ATG proteins to the autophagosome formation site. Koyama-Honda I, Itakura E, Fujiwara TK, Mizushima N. Autophagy. 2013 Oct;9(10):1491-9. doi: 10.4161/auto.25529. Epub 2013 Jul 10. 10.4161/auto.25529 PubMed 23884233