Skip to main content

pMRX-IP/SECFP-hATG16A1
(Plasmid #58994)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58994 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMRXIP GFP-Ci2
  • Backbone manufacturer
    Dr.Shoji Yamaoka of Tokyo Medical and Dental University
  • Backbone size w/o insert (bp) 6600
  • Vector type
    Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Homo sapiens autophagy related 16-like 1 (S. cerevisiae)
  • Alt name
    ATG16L1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1765
  • GenBank ID
    NM_017974
  • Entrez Gene
    ATG16L1 (a.k.a. APG16L, ATG16A, ATG16L, IBD10, WDR30)
  • Tag / Fusion Protein
    • SECFP (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CGACCACTACCAGCAGAACA
  • 3′ sequencing primer AAAAGACGGCAATATGGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    It has the pMX backbone
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMRX-IP/SECFP-hATG16A1 was a gift from Noboru Mizushima (Addgene plasmid # 58994 ; http://n2t.net/addgene:58994 ; RRID:Addgene_58994)
  • For your References section:

    Temporal analysis of recruitment of mammalian ATG proteins to the autophagosome formation site. Koyama-Honda I, Itakura E, Fujiwara TK, Mizushima N. Autophagy. 2013 Oct;9(10):1491-9. doi: 10.4161/auto.25529. Epub 2013 Jul 10. 10.4161/auto.25529 PubMed 23884233