-
Purposefor baculovirus expression of CAMSAP2 in Sf9 cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59037 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepFasBac
-
Modifications to backboneeGFP added between BamHI and XhoI sites
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCAMSAP2
-
SpeciesH. sapiens (human)
-
Entrez GeneCAMSAP2 (a.k.a. CAMSAP1L1)
-
Tags
/ Fusion Proteins
- His (N terminal on insert)
- eGFP (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer AAATGATAACCATCTCGC
- 3′ sequencing primer CAAATGTGGTATGGCTGATT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFasBac+GFP-CAMSAP2 was a gift from Ron Vale (Addgene plasmid # 59037 ; http://n2t.net/addgene:59037 ; RRID:Addgene_59037) -
For your References section:
Regulation of microtubule minus-end dynamics by CAMSAPs and Patronin. Hendershott MC, Vale RD. Proc Natl Acad Sci U S A. 2014 Apr 22;111(16):5860-5. doi: 10.1073/pnas.1404133111. Epub 2014 Mar 26. 10.1073/pnas.1404133111 PubMed 24706919