Skip to main content
Addgene

pMKO.1-puro/hFOXH1 shRNA1
(Plasmid #59303)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59303 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMKO.1-puro
  • Backbone manufacturer
    Addgene Plasmid #8452
  • Backbone size w/o insert (bp) 6700
  • Total vector size (bp) 6758
  • Vector type
    Retroviral, RNAi
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    hFOXH1 shRNA
  • Alt name
    FOXH1
  • gRNA/shRNA sequence
    CCGGCACCTCCTACTTGCCTATCTACTCGAGTAGATAGGCAAGTAGGAGGTGTTTTTG
  • Species
    H. sapiens (human)
  • GenBank ID
    NM_003923
  • Entrez Gene
    FOXH1 (a.k.a. FAST-1, FAST1)
  • Promoter hU6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer hU6 F
  • 3′ sequencing primer SV40 R
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMKO.1-puro/hFOXH1 shRNA1 was a gift from Shinya Yamanaka (Addgene plasmid # 59303 ; http://n2t.net/addgene:59303 ; RRID:Addgene_59303)
  • For your References section:

    Induction of pluripotency in human somatic cells via a transient state resembling primitive streak-like mesendoderm. Takahashi K, Tanabe K, Ohnuki M, Narita M, Sasaki A, Yamamoto M, Nakamura M, Sutou K, Osafune K, Yamanaka S. Nat Commun. 2014 Apr 24;5:3678. doi: 10.1038/ncomms4678. 10.1038/ncomms4678 PubMed 24759836