Skip to main content
Holiday Schedule: Addgene will be closed December 23 - January 2. Order processing and shipping will resume on January 3, 2023. For questions about estimated ship dates, please feel free to track your order status or contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #59326)


Item Catalog # Description Quantity Price (USD)
Plasmid 59326 Standard format: Plasmid sent in bacteria as agar stab 1 $75

Currently unavailable outside the U.S.

This material is available to academics and nonprofits only.


  • Vector backbone
    cSPBN (pSAD)
  • Backbone manufacturer
    Karl-Klaus Conzelmann & Matthias Schnell
  • Backbone size w/o insert (bp) 13782
  • Total vector size (bp) 15252
  • Vector type
    Mammalian Expression ; Rabies Virus

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    DH5alpha at 37C
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CATCAAAGTCAAGTTGATTACC
  • 3′ sequencing primer TAGACCTCTCCAGGATCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternative name: pRVdG-4ArchTC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRVdG-4ArchT-mCherry was a gift from Ian Wickersham (Addgene plasmid # 59326 ; ; RRID:Addgene_59326)