pRVdG-4ChR2-mCherry
(Plasmid
#59328)
-
PurposeExpresses ChR2-mCherry
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59328 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backbonecSPBN (pSAD)
-
Backbone manufacturerKarl-Klaus Conzelmann & Matthias Schnell
- Backbone size w/o insert (bp) 13782
- Total vector size (bp) 15432
-
Vector typeMammalian Expression ; Rabies Virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChR2-mCherry
-
SpeciesSynthetic
-
Insert Size (bp)1650
-
MutationH134R
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATCAAAGTCAAGTTGATTACC
- 3′ sequencing primer TAGACCTCTCCAGGATCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Alternative name: pRVdG-4ChR2C
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRVdG-4ChR2-mCherry was a gift from Ian Wickersham (Addgene plasmid # 59328 ; http://n2t.net/addgene:59328 ; RRID:Addgene_59328)