-
Purpose(Empty Backbone) Contains BioBrick prefixed and suffixed insert with a modified lac promoter, Shine-Delgarno sequence, 5’ & 3’ MCS, 3’ 6xHis tag.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59449 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSRK21
- Backbone size (bp) 5417
-
Modifications to backboneWe removed all BioBrick™ incompatible sites from pSRK21, as well as sites incompatible with our in-house optimized BioBrick™ system: EcoRI, 2 x NcoI and BglII. We removed the original MCS and replaced it with our optimized BioBrick™ insert.
-
Vector typeBacterial Expression
- Promoter modified lac
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructions30 µg/mL kanamycin; 37C for propagation in E. coli. JM109 E. coli can also be used. Rhodococcus opacus strain PD630 is recommended- minimum 50 µg/mL kanamycin. Grow at 30 C when using R. opacus PD630. Depositor growth data show that up to 300 µg/mL kanamycin permits growth.
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer TTCATTAATGCAGCTGGCACGAC
- 3′ sequencing primer TCTGCGGACTGGCTTTCTACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe plasmid backbone used to derive this plasmid was pSRK21. We received this backbone from Miroslav Pátek at the Institute of Microbiology AS CR, Czech Republic
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSRKBB-empty was a gift from Claudia Schmidt-dannert (Addgene plasmid # 59449 ; http://n2t.net/addgene:59449 ; RRID:Addgene_59449)