Skip to main content

pAAV-CAG-tdTomato (codon diversified)
(Plasmid and Viral Vector Preps for #59462)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59462 Standard format: Plasmid sent in bacteria as agar stab 1 $94
AAV1 59462-AAV1 Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. $459
AAV2 59462-AAV2 Virus (100 µL at titer ≥ 4×10¹² vg/mL) and Plasmid. $459
AAV5 59462-AAV5 Virus (100 µL at titer ≥ 5×10¹² vg/mL) and Plasmid. $459
AAV8 59462-AAV8 Limited Stock Available, 2 units left
Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid.
$459
AAV9 59462-AAV9 Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $459
AAV Retrograde 59462-AAVrg Virus (100µL at titer ≥ 7×10¹² vg/mL) and Plasmid. $459
AAV PHP.S 59462-PHP.S Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $459
AAV PHP.eB 59462-PHPeB Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. $459

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV with CAG promter
  • Backbone manufacturer
    Scott Sternson
  • Backbone size w/o insert (bp) 4719
  • Total vector size (bp) 6150
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Stbl3 at 30C (use carbenicillin if using Stbl3) OR DH5a at 37C
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    tdTomato
  • Species
    Synthetic
  • Insert Size (bp)
    1431
  • Mutation
    codon diversified
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gctctagagcctctgctaacc
  • 3′ sequencing primer gcagcgtatccacatagcg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid is completely sequenced by depositing lab except for parts of both ITRs and a part of the CAG promoter. Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

Purpose

Ready-to-use AAV1 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV1
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Purpose

Ready-to-use AAV2 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 4×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV2 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV2
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Purpose

Ready-to-use AAV5 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 5×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV5
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Purpose

Ready-to-use AAV8 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV8
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Purpose

Ready-to-use AAV9 particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype AAV9
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Purpose

Ready-to-use AAV Retrograde particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

tdTomato expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 7×10¹² vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
  • Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
  • Serotype AAV retrograde (AAVrg)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.

Data submitted about 59462-AAVrg by requesting scientist(s):

Purpose

Ready-to-use AAV PHP.S particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV were produced with the PHP.S serotype, which permits efficient transduction of the peripheral nervous system. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, PHP.S cap gene
    pUCmini-iCAP-PHP.S (plasmid #103006)
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype PHP.S (plasmid #103006)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Citation Information: When using the PHP.S serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.

Data submitted about 59462-PHP.S by requesting scientist(s):

Purpose

Ready-to-use AAV PHP.eB particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA.

CAG-driven tdTomato expression control. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.

Delivery

  • Volume 100 µL
  • Titer ≥ 1×10¹³ vg/mL
  • Pricing $425 USD for preparation of 100 µL virus + $34 USD for plasmid.
  • Storage Store at -80℃. Thaw just before use and keep on ice.
  • Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

  • Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, PHP.eB cap gene
    pUCmini-iCAP-PHP.eB (plasmid #103005)
  • Buffer PBS + 0.001% Poloxamer 188
  • Serotype PHPeB (plasmid #103005)
  • Purification Iodixanol gradient ultracentrifugation
  • Reporter Gene tdTomato (codon diversified)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

Viral Quality Control

Quality Control:
  • Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
  • Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Citation Information: When using the PHP.eB serotype in future publications, please acknowledge Viviana Gradinaru and cite Chan et al., Nat Neurosci, 20(8):1172-1179. Pubmed.

Data submitted about 59462-PHPeB by requesting scientist(s):

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CAG-tdTomato (codon diversified) was a gift from Edward Boyden (Addgene plasmid # 59462 ; http://n2t.net/addgene:59462 ; RRID:Addgene_59462) For viral preps, please replace (Addgene plasmid # 59462) in the above sentence with: (Addgene viral prep # 59462-AAV1), (Addgene viral prep # 59462-AAV2), (Addgene viral prep # 59462-AAV5), (Addgene viral prep # 59462-AAV8), (Addgene viral prep # 59462-AAV9), (Addgene viral prep # 59462-AAVrg), (Addgene viral prep # 59462-PHP.S), or (Addgene viral prep # 59462-PHPeB)