Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

REV human NANOS3 TALEN
(Plasmid #59723)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59723 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pc-Goldy TALEN
  • Backbone manufacturer
    Dan Carlson lab plasmids (from addgene)
  • Vector type
    Mammalian Expression, TALEN

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NG NH HD HD HD NI HD HD NG NH NG NI NH NH HD NI
  • Species
    Synthetic
  • Promoter CAGGS

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Esp3I (destroyed during cloning)
  • 3′ cloning site Esp3I (destroyed during cloning)
  • 5′ sequencing primer AGGCGACACACGAAGACATC
  • 3′ sequencing primer CGGCGATTGACTCTTCTGAT
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    REV human NANOS3 TALEN was a gift from Jacob Hanna (Addgene plasmid # 59723 ; http://n2t.net/addgene:59723 ; RRID:Addgene_59723)
  • For your References section:

    SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate. Naoko Irie, Leehee Weinberger, Walfred W.C. Tang, Toshihiro Kobayashi, Sergey Viukov, Yair S. Manor, Sabine Dietmann, Jacob H. Hanna, M. Azim Surani. Cell 160, 1–16, January 15, 2015 10.1016/j.cell.2014.12.013