Skip to main content
Addgene

Human NANOS3-P2A-mCherry knock-in targeting construct
(Plasmid #59721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59721 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pNeoTK
  • Total vector size (bp) 8294
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    P2A mCherry
  • Species
    Synthetic
  • Insert Size (bp)
    837

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggaacttcctgactaggggag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human NANOS3-P2A-mCherry knock-in targeting construct was a gift from Jacob Hanna (Addgene plasmid # 59721 ; http://n2t.net/addgene:59721 ; RRID:Addgene_59721)
  • For your References section:

    SOX17 is a critical specifier of human primordial germ cell fate. Irie N, Weinberger L, Tang WW, Kobayashi T, Viukov S, Manor YS, Dietmann S, Hanna JH, Surani MA. Cell. 2015 Jan 15;160(1-2):253-68. doi: 10.1016/j.cell.2014.12.013. Epub 2014 Dec 24. 10.1016/j.cell.2014.12.013 PubMed 25543152