Human NANOS3-P2A-mCherry knock-in targeting construct
(Plasmid #59721)

• Purpose: Gene targeting construct for human NANOS3 locus, introducing a P2A-mCherry reporter gene. Contains an frt-PGK-Neo-PA-frt cassette that can be excised.
• Depositing Lab: Jacob Hanna
• Publication: Irie et al Cell. 2015 Jan 15;160(1-2):253-68. doi: 10.1016/j.cell.2014.12.013. Epub 2014 Dec 24.

Backbone

• Vector backbone: pNeoTK
• Total vector size (bp): 8294
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: P2A mCherry
• Species: Synthetic
• Insert Size (bp): 837

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: ggaacttcctgactaggggag

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry