Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Human NANOS3-P2A-mCherry knock-in targeting construct
(Plasmid #59721)


Item Catalog # Description Quantity Price (USD)
Plasmid 59721 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 8294
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    P2A mCherry
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer ggaacttcctgactaggggag
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Human NANOS3-P2A-mCherry knock-in targeting construct was a gift from Jacob Hanna (Addgene plasmid # 59721 ; ; RRID:Addgene_59721)
  • For your References section:

    SOX17 Is a Critical Specifier of Human Primordial Germ Cell Fate. Naoko Irie, Leehee Weinberger, Walfred W.C. Tang, Toshihiro Kobayashi, Sergey Viukov, Yair S. Manor, Sabine Dietmann, Jacob H. Hanna, M. Azim Surani. Cell 160, 1–16, January 15, 2015 10.1016/j.cell.2014.12.013