Skip to main content
Addgene

pcDNA-EGFP-ELYS-polyA
(Plasmid #59746)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59746 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pcDNA3.1-polyA
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    EGFP-ELYS
  • Species
    M. musculus (mouse)
  • Promoter CMV and T7
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer CCAAACTTTTATTTGTGCACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-EGFP-ELYS-polyA was a gift from Yi Zhang (Addgene plasmid # 59746 ; http://n2t.net/addgene:59746 ; RRID:Addgene_59746)
  • For your References section:

    Nucleosome assembly is required for nuclear pore complex assembly in mouse zygotes. Inoue A, Zhang Y. Nat Struct Mol Biol. 2014 Jul;21(7):609-16. doi: 10.1038/nsmb.2839. Epub 2014 Jun 8. 10.1038/nsmb.2839 PubMed 24908396