Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNSEN-d2
(Plasmid #59763)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59763 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pUC
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    d2-EGFP
  • Alt name
    destablized EGFP
  • Insert Size (bp)
    935
  • Promoter SV40 promoter
  • Tags / Fusion Proteins
    • 3X NLS (N terminal on insert)
    • PEST (C terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer GACGAAAGATTGGTGTGGAAAGTCC
  • 3′ sequencing primer atcatcctgctcctccacctcc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    Tomato
  • Alt name
    monomeric Tomato
  • Insert Size (bp)
    785
  • Promoter CMV promoter
  • Tag / Fusion Protein
    • 3X NLS (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CACTGCAATCTCGTGATACGCCTA
  • 3′ sequencing primer tgatgagtttggacaaaccacaac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNSEN-d2 was a gift from Jerry Crabtree (Addgene plasmid # 59763 ; http://n2t.net/addgene:59763 ; RRID:Addgene_59763)
  • For your References section:

    MicroRNA-mediated switching of chromatin-remodelling complexes in neural development. Yoo AS, Staahl BT, Chen L, Crabtree GR. Nature. 2009 Jul 30;460(7255):642-6. doi: 10.1038/nature08139. Epub 2009 Jun 28. 10.1038/nature08139 PubMed 19561591