Skip to main content

pKTrfp
(Plasmid #59772)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59772 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKT230
  • Backbone size w/o insert (bp) 8144
  • Total vector size (bp) 8821
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH10B
  • Growth instructions
    Grow for 2 days
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rfp
  • Insert Size (bp)
    677
  • Promoter pBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer taccatgctcagaaaaggcttaaca
  • 3′ sequencing primer acgggaatttgaagaatttctccaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKTrfp was a gift from Nathan Hillson (Addgene plasmid # 59772 ; http://n2t.net/addgene:59772 ; RRID:Addgene_59772)
  • For your References section:

    Development of a broad-host synthetic biology toolbox for Ralstonia eutropha and its application to engineering hydrocarbon biofuel production. Bi C, Su P, Muller J, Yeh YC, Chhabra SR, Beller HR, Singer SW, Hillson NJ. Microb Cell Fact. 2013 Nov 13;12:107. doi: 10.1186/1475-2859-12-107. 10.1186/1475-2859-12-107 PubMed 24219429