-
PurposepKT230 derivative; PBAD_rfp; cmR
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59772 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKT230
- Backbone size w/o insert (bp) 8144
- Total vector size (bp) 8821
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH10B
-
Growth instructionsGrow for 2 days
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerfp
-
Insert Size (bp)677
- Promoter pBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taccatgctcagaaaaggcttaaca
- 3′ sequencing primer acgggaatttgaagaatttctccaa (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKTrfp was a gift from Nathan Hillson (Addgene plasmid # 59772 ; http://n2t.net/addgene:59772 ; RRID:Addgene_59772) -
For your References section:
Development of a broad-host synthetic biology toolbox for Ralstonia eutropha and its application to engineering hydrocarbon biofuel production. Bi C, Su P, Muller J, Yeh YC, Chhabra SR, Beller HR, Singer SW, Hillson NJ. Microb Cell Fact. 2013 Nov 13;12:107. doi: 10.1186/1475-2859-12-107. 10.1186/1475-2859-12-107 PubMed 24219429