pBbE1k-2
(Plasmid
#59945)
-
Purposedihydropterine reductase from human, pterin-4a-carbinolamine dehydratase from human
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59945 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBbE1k
- Backbone size w/o insert (bp) 3550
- Total vector size (bp) 4598
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedihydropterine reductase
-
Alt nameDHPR
-
Insert Size (bp)734
- Promoter pTrc
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AACTATCCGCTGGATGACCA
- 3′ sequencing primer CGTTCTTTCGGTAGGTCAAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namepterin-4a-carbinolamine dehydratase
-
Alt namePCD
-
Insert Size (bp)314
- Promoter pTrc
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer AACTATCCGCTGGATGACCA
- 3′ sequencing primer CGTTCTTTCGGTAGGTCAAA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBbE1k-2 was a gift from Taek Soon Lee (Addgene plasmid # 59945 ; http://n2t.net/addgene:59945 ; RRID:Addgene_59945) -
For your References section:
Engineering of L-tyrosine oxidation in Escherichia coli and microbial production of hydroxytyrosol. Satoh Y, Tajima K, Munekata M, Keasling JD, Lee TS. Metab Eng. 2012 Nov;14(6):603-10. doi: 10.1016/j.ymben.2012.08.002. Epub 2012 Aug 29. 10.1016/j.ymben.2012.08.002 PubMed 22948011