pNB753
(Plasmid
#60148)
-
PurposeGreen beetle luciferase with nuclear localization signal (NLS) and ClpXP degron tag (ssrA), driven by LEU1 promoter.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60148 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonep406
- Backbone size w/o insert (bp) 6260
- Total vector size (bp) 8018
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGrLuc
-
Alt nameGreen beetle luciferase
-
Alt namep406-LEU1pr-NLS-GrLuc-ssrA
-
SpeciesSynthetic
-
Insert Size (bp)1758
- Promoter LEU1pr
-
Tags
/ Fusion Proteins
- Nuclear localization signal (NLS) (N terminal on insert)
- ClpXP degron (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site PacI (not destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer cactttatgcttccggctcctatgtt
- 3′ sequencing primer CTGCCGGTAGAGGTGTGGTCAATAAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pNB753 was a gift from Nicolas Buchler (Addgene plasmid # 60148 ; http://n2t.net/addgene:60148 ; RRID:Addgene_60148) -
For your References section:
Measuring fast gene dynamics in single cells with time-lapse luminescence microscopy. Mazo-Vargas A, Park H, Aydin M, Buchler NE. Mol Biol Cell. 2014 Sep 17. pii: mbc.E14-07-1187. 10.1091/mbc.E14-07-1187 PubMed 25232010