-
PurposeMouse NLRC4 expressed under the constitutive, moderate-level retroviral LTR promoter, expresses in mammalian cells; IRES-GFP reporter downstream of NLRC4
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60199 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemscv2.2
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNLRC4
-
SpeciesM. musculus (mouse)
-
Entrez GeneNlrc4 (a.k.a. 9530011P19Rik, CLAN, CLAN1, CLANA, CLANB, CLANC, CLAND, Card12, IPAF)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AAGCCCTTTGTACACCCTAAGCC
- 3′ sequencing primer CCTCACATTGCCAAAAGAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mscv2.2-NLRC4 was a gift from Russell Vance (Addgene plasmid # 60199 ; http://n2t.net/addgene:60199 ; RRID:Addgene_60199) -
For your References section:
Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificity. Kofoed EM, Vance RE. Nature. 2011 Aug 28;477(7366):592-5. doi: 10.1038/nature10394. 10.1038/nature10394 PubMed 21874021