Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #60200)


Item Catalog # Description Quantity Price (USD)
Plasmid 60200 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Promoter LTR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer AAGCCCTTTGTACACCCTAAGCC
  • 3′ sequencing primer CCTCACATTGCCAAAAGAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mscv2.2-NAIP1 was a gift from Russell Vance (Addgene plasmid # 60200 ; ; RRID:Addgene_60200)
  • For your References section:

    Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificity. Kofoed EM, Vance RE. Nature. 2011 Aug 28;477(7366):592-5. doi: 10.1038/nature10394. 10.1038/nature10394 PubMed 21874021