pENTR D-TOPO-C2_14
(Plasmid
#60253)
-
PurposeThis plasmid contains a human pancreatic islet inactive enhancer, which can be shuttled into a Gateway destination vector, such as pGL4.23-Gateway.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60253 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepENTR/D-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2580
-
Vector typeEntry Vector
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEDARADD inactive enhancer
-
Alt nameEDARADD
-
SpeciesH. sapiens (human)
-
Entrez GeneEDARADD (a.k.a. ECTD11A, ECTD11B, ED3, EDA3)
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13 Fw
- 3′ sequencing primer M13 Rev (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
chromosome : chr1; start: 234595797 end: 234596272 (genomic position corresponds to the version of the human genome hg18)
Fw primer used for cloning: CACCTTCTGCAATGTTTAATCTGC Rv primer used for cloning: GGTCTCAGCTCAGTGGTAGGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENTR D-TOPO-C2_14 was a gift from Jorge Ferrer (Addgene plasmid # 60253 ; http://n2t.net/addgene:60253 ; RRID:Addgene_60253) -
For your References section:
Pancreatic islet enhancer clusters enriched in type 2 diabetes risk-associated variants. Pasquali L, Gaulton KJ, Rodriguez-Segui SA, Mularoni L, Miguel-Escalada I, Akerman I, Tena JJ, Moran I, Gomez-Marin C, van de Bunt M, Ponsa-Cobas J, Castro N, Nammo T, Cebola I, Garcia-Hurtado J, Maestro MA, Pattou F, Piemonti L, Berney T, Gloyn AL, Ravassard P, Gomez-Skarmeta JL, Muller F, McCarthy MI, Ferrer J. Nat Genet. 2014 Feb;46(2):136-43. doi: 10.1038/ng.2870. Epub 2014 Jan 12. 10.1038/ng.2870 PubMed 24413736