pGL2 HNF4A P2 wt
(Plasmid
#60324)
-
PurposeHNF4A P2 promoter cloned into the pGL2-basic backbone.
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60324 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepGL2-basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 5598
-
Vector typeMammalian Expression, Luciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNM_000457.4
-
SpeciesH. sapiens (human)
-
Entrez GeneHNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
-
Tag
/ Fusion Protein
- Luciferase (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (not destroyed)
- 3′ cloning site Unknown (not destroyed)
- 5′ sequencing primer GLprimer2 (Promega): CTTTATGTTTTTGGCGTCTTCCA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
–371 to –37 from HNF4A TSS
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL2 HNF4A P2 wt was a gift from Jorge Ferrer (Addgene plasmid # 60324 ; http://n2t.net/addgene:60324 ; RRID:Addgene_60324) -
For your References section:
Genetic evidence that HNF-1alpha-dependent transcriptional control of HNF-4alpha is essential for human pancreatic beta cell function. Hansen SK, Parrizas M, Jensen ML, Pruhova S, Ek J, Boj SF, Johansen A, Maestro MA, Rivera F, Eiberg H, Andel M, Lebl J, Pedersen O, Ferrer J, Hansen T. J Clin Invest. 2002 Sep;110(6):827-33. 10.1172/JCI15085 PubMed 12235114