Skip to main content

pLL7.0: mTiam1(64-437)-tgRFPt-SSPB WT
(Plasmid #60417)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60417 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLentiLox7.0
  • Vector type
    Mammalian Expression, Lentiviral, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mTiam1-tgRFPt-SSPB
  • Species
    M. musculus (mouse), Synthetic
  • Insert Size (bp)
    2289
  • Mutation
    mTiam 64-437
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site ApaI (not destroyed)
  • 3′ cloning site PciI (not destroyed)
  • 5′ sequencing primer None
  • 3′ sequencing primer CAGCAACCAGGATTTATACAAGG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL7.0: mTiam1(64-437)-tgRFPt-SSPB WT was a gift from Brian Kuhlman (Addgene plasmid # 60417)
  • For your References section:

    Engineering an improved light-induced dimer (iLID) for controlling the localization and activity of signaling proteins. Guntas G, Hallett RA, Zimmerman SP, Williams T, Yumerefendi H, Bear JE, Kuhlman B. Proc Natl Acad Sci U S A. 2015 Jan 6;112(1):112-7. doi: 10.1073/pnas.1417910112. Epub 2014 Dec 22. 10.1073/pnas.1417910112 PubMed 25535392