Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #60421)


Item Catalog # Description Quantity Price (USD)
Plasmid 60421 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Life Technologies
  • Backbone size w/o insert (bp) 5376
  • Total vector size (bp) 6684
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CMV
  • Tag / Fusion Protein
    • Nuclear Export Signal (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GAGGTCTATATAAGCAGAGC
  • 3′ sequencing primer AGATGGCTGGCAACTAGAAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Eric Schreiter created this plasmid.
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3-CaMPARI was a gift from Loren Looger & Eric Schreiter (Addgene plasmid # 60421 ; ; RRID:Addgene_60421)
  • For your References section:

    Neural circuits. Labeling of active neural circuits in vivo with designed calcium integrators. Fosque BF, Sun Y, Dana H, Yang CT, Ohyama T, Tadross MR, Patel R, Zlatic M, Kim DS, Ahrens MB, Jayaraman V, Looger LL, Schreiter ER. Science. 2015 Feb 13;347(6223):755-60. doi: 10.1126/science.1260922. 10.1126/science.1260922 PubMed 25678659