Skip to main content

pSBtet-GP
(Plasmid #60495)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60495 Standard format: Plasmid sent in bacteria as agar stab 1 $89
Cloning Grade DNA 60495-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $110

Backbone

  • Vector backbone
    pUC19
  • Backbone size (bp) 2021
  • Vector type
    Mammalian Expression ; Transposon
  • Promoter TCE & RPBSA
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CCTGGAGCCAATTCCAACTCT
  • 3′ sequencing primer CACTGCATTCTTGTTGTGGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Information for Cloning Grade DNA (Catalog # 60495-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $110 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBtet-GP was a gift from Eric Kowarz (Addgene plasmid # 60495 ; http://n2t.net/addgene:60495 ; RRID:Addgene_60495)
  • For your References section:

    Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines. Kowarz E, Loescher D, Marschalek R. Biotechnol J. 2015 Feb 4. doi: 10.1002/biot.201400821. 10.1002/biot.201400821 PubMed 25650551