Skip to main content

pSBbi-BP
(Plasmid #60512)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60512 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Backbone size (bp) 2021
  • Vector type
    Mammalian Expression ; Transposon
  • Promoter EF1a/RPBSA
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
  • 3′ sequencing primer AGGCACAGTCGAGGCTGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSBbi-BP was a gift from Eric Kowarz (Addgene plasmid # 60512 ; http://n2t.net/addgene:60512 ; RRID:Addgene_60512)
  • For your References section:

    Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines. Kowarz E, Loescher D, Marschalek R. Biotechnol J. 2015 Feb 4. doi: 10.1002/biot.201400821. 10.1002/biot.201400821 PubMed 25650551