-
Purpose(Empty Backbone) SB-transposon with constitutive bi-directional promoter, one side: SfiI cloning site for GOI (contains filler DNA), other side: hygromycin resistance gene
-
Depositing Lab
-
Depositing OrganizationGoethe-Universitaet Frankfurt am Main
Located in Germany -
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60524 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Backbone size (bp) 2021
-
Vector typeMammalian Expression ; Transposon
- Promoter EF1a/RPBSA
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCCTCAGACAGTGGTTCAAAG
- 3′ sequencing primer AGGCACAGTCGAGGCTGAT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that an SfiI digest will affect the Kozak sequence that is already present upstream of the insertion site for the gene of interest. This can be addressed by adding the 3 bases 'ACC' between the 5'-SfiI site and the start codon of your gene of interest:
5'-SfiI---> ggcctctgaggcc ACC atg <---start codon
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSBbi-Hyg was a gift from Eric Kowarz (Addgene plasmid # 60524 ; http://n2t.net/addgene:60524 ; RRID:Addgene_60524) -
For your References section:
Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines. Kowarz E, Loescher D, Marschalek R. Biotechnol J. 2015 Feb 4. doi: 10.1002/biot.201400821. 10.1002/biot.201400821 PubMed 25650551