PB-Sox17
(Plasmid
#60669)
-
PurposePiggyBac expression vector encoding murine Sox17 downstream of a doxycycline inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBTO-Dest
-
Backbone manufacturerThomson lab
- Backbone size w/o insert (bp) 4182
- Total vector size (bp) 5442
-
Vector typeMammalian Expression ; PiggyBac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSox17
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1260
-
Entrez GeneSox17
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ATCCACGCTGTTTTGACCTC
- 3′ sequencing primer GCTCTAGAGTCGGTGACTAGTATCAAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGenecopoeia
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PB-Sox17 was a gift from James Thomson (Addgene plasmid # 60669 ; http://n2t.net/addgene:60669 ; RRID:Addgene_60669) -
For your References section:
An expandable, inducible hemangioblast state regulated by fibroblast growth factor. Vereide DT, Vickerman V, Swanson SA, Chu LF, McIntosh BE, Thomson JA. Stem Cell Reports. 2014 Dec 9;3(6):1043-57. doi: 10.1016/j.stemcr.2014.10.003. Epub 2014 Nov 13. 10.1016/j.stemcr.2014.10.003 PubMed 25458896