Skip to main content

pUCX
(Plasmid #60681)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60681 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC19
  • Vector type
    Bacterial Expression
  • Promoter tac

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    All temps fine
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GGCTCGTATAATGTGTGG)
  • 3′ sequencing primer GACCGCTTCTGCGTTCTGAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUCX was a gift from David Ackerley (Addgene plasmid # 60681 ; http://n2t.net/addgene:60681 ; RRID:Addgene_60681)
  • For your References section:

    A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning. Prosser GA, Williams EM, Sissons JA, Walmsley KE, Parker MR, Ackerley DF. Biotechnol Lett. 2014 Sep 26. 10.1007/s10529-014-1673-4 PubMed 25257589