pTSara-N
(Plasmid
#60721)
-
PurposeExpresses the N-terminal fragment of split T7 RNAP split a position 179. Insert is driven by PBAD. Contains a constitutive araC ORF
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60721 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD33
- Backbone size w/o insert (bp) 5500
- Total vector size (bp) 6040
-
Modifications to backboneArabinose inducible ORF driving expression of the N-terminal fragment of T7 RNAP split between position 179-180
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameResidues 1-179 of T7 RNAP
-
SpeciesSynthetic; T7 Phage
-
Insert Size (bp)540
-
MutationOnly amino acids 1-179 of T7 RNAP
-
GenBank IDGI:216012
- Promoter PBAD
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cacggcagaaaagtcctaggacattgattatttgcacggcgtcacac (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTSara-N was a gift from Matthew Bennett (Addgene plasmid # 60721 ; http://n2t.net/addgene:60721 ; RRID:Addgene_60721) -
For your References section:
Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants. Shis DL, Bennett MR. Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11. 10.1073/pnas.1220157110 PubMed 23479654