Skip to main content

pTSara-N
(Plasmid #60721)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60721 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pBAD33
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 6040
  • Modifications to backbone
    Arabinose inducible ORF driving expression of the N-terminal fragment of T7 RNAP split between position 179-180
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Residues 1-179 of T7 RNAP
  • Species
    Synthetic; T7 Phage
  • Insert Size (bp)
    540
  • Mutation
    Only amino acids 1-179 of T7 RNAP
  • GenBank ID
    GI:216012
  • Promoter PBAD

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer cacggcagaaaagtcctaggacattgattatttgcacggcgtcacac
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSara-N was a gift from Matthew Bennett (Addgene plasmid # 60721 ; http://n2t.net/addgene:60721 ; RRID:Addgene_60721)
  • For your References section:

    Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants. Shis DL, Bennett MR. Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11. 10.1073/pnas.1220157110 PubMed 23479654