pTriEx-mCherry::LANS1
(Plasmid
#60784)
-
PurposeControl of Protein Activity and Cell Fate Specification via Light-Mediated Nuclear Translocation
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTriEx
- Backbone size w/o insert (bp) 5943
- Total vector size (bp) 6429
-
Vector typeMammalian Expression, Bacterial Expression, Insect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLANS1
-
SpeciesSynthetic; Avena Sativa
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CCCAACACAATATATTATAGTTAAATAAGAATTATTATC
- 3′ sequencing primer GGTGGTGCTCGAGATCCTCGGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTriEx-mCherry::LANS1 was a gift from Brian Kuhlman (Addgene plasmid # 60784 ; http://n2t.net/addgene:60784 ; RRID:Addgene_60784) -
For your References section:
Control of Protein Activity and Cell Fate Specification via Light-Mediated Nuclear Translocation. Yumerefendi H, Dickinson DJ, Wang H, Zimmerman SP, Bear JE, Goldstein B, Hahn K, Kuhlman B. PLoS One. 2015 Jun 17;10(6):e0128443. doi: 10.1371/journal.pone.0128443. eCollection 2015. PONE-D-15-08811 [pii] PubMed 26083500