Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pCMB-AUTr
(Plasmid #61205)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61205 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pK7m34GW
  • Backbone manufacturer
    VIB
  • Vector type
    Plant Expression
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    LC3(ATG8)
  • Insert Size (bp)
    363
  • Promoter MtBCP1
  • Tag / Fusion Protein
    • mCherry

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ATGGCTAAGAGTTCCTTCAAATTG
  • 3′ sequencing primer TCACATTAACATCCCAAAAGTGTT
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMB-AUTr was a gift from Maria Harrison (Addgene plasmid # 61205 ; http://n2t.net/addgene:61205 ; RRID:Addgene_61205)
  • For your References section:

    A set of fluorescent protein-based markers expressed from constitutive and arbuscular mycorrhiza-inducible promoters to label organelles, membranes and cytoskeletal elements in Medicago truncatula. Ivanov S, Harrison MJ. Plant J. 2014 Oct 20. doi: 10.1111/tpj.12706. 10.1111/tpj.12706 PubMed 25329881