Skip to main content

pENTR-TER+-shLKB1-Ms
(Plasmid #61234)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61234 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pENTR/pTER+
  • Backbone manufacturer
    Eric Campeau
  • Vector type
    ENTR clone

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shLkb1 (Ms/Hu)
  • gRNA/shRNA sequence
    CGCCAAGCTCATCGGCAAGTA
  • Species
    H. sapiens (human), M. musculus (mouse)
  • GenBank ID
    NM_011492.4
  • Entrez Gene
    STK11 (a.k.a. LKB1, PJS, hLKB1)
  • Entrez Gene
    Stk11 (a.k.a. Lkb1, Par-4)
  • Promoter H1/TO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BglII (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer H1
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENTR-TER+-shLKB1-Ms was a gift from Reuben Shaw (Addgene plasmid # 61234 ; http://n2t.net/addgene:61234 ; RRID:Addgene_61234)
  • For your References section:

    An AMPK-independent signaling pathway downstream of the LKB1 tumor suppressor controls Snail1 and metastatic potential. Goodwin JM, Svensson RU, Lou HJ, Winslow MM, Turk BE, Shaw RJ. Mol Cell. 2014 Aug 7;55(3):436-50. doi: 10.1016/j.molcel.2014.06.021. Epub 2014 Jul 17. 10.1016/j.molcel.2014.06.021 PubMed 25042806