-
PurposeIncP-based replicating vector expressing dTomato under tac promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAWP78
- Total vector size (bp) 5756
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePtac-dTomato
-
Insert Size (bp)777
-
GenBank IDAY678268.1
- Promoter tac
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGAAAGGCGGACAGGTATC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydTomato from pUltra-Chili-Luc (Addgene plasmid #48688 https://www.addgene.org/48688/)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
dTomato reference:
Shaner, N. C., Campbell, R. E., Steinbach, P. A., Giepmans, B. N. G., Palmer, A. E., & Tsien, R. Y. (2004). Improved monomeric red, orange and yellow fluorescent proteins derived from Discosoma sp. red fluorescent protein. Nature Biotechnology, 22(12), 1567–1572. doi:10.1038/nbt1037
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAWP89 was a gift from Mary Lidstrom (Addgene plasmid # 61264 ; http://n2t.net/addgene:61264 ; RRID:Addgene_61264) -
For your References section:
Genetic tools for the industrially promising methanotroph Methylomicrobium buryatense. Puri AW, Owen S, Chu F, Chavkin T, Beck DA, Kalyuzhnaya MG, Lidstrom ME. Appl Environ Microbiol. 2014 Dec 29. pii: AEM.03795-14. 10.1128/AEM.03795-14 PubMed 25548049