Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

RAB14 S25N
(Plasmid #61495)


Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 61495 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    a dual promoter lentivector made by the Civin lab
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    S25N, inactive form
  • GenBank ID
  • Entrez Gene
    RAB14 (a.k.a. FBP, RAB-14)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer WCC43-F-seq TTCATTCTCAAGCCTCAGAC
  • 3′ sequencing primer WCC43-R-seq CGGACGCTCGCTGCGCCCTTCG
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RAB14 S25N was a gift from Curt Civin (Addgene plasmid # 61495 ; ; RRID:Addgene_61495)
  • For your References section:

    MIR144 and MIR451 regulate human erythropoiesis via RAB14. Kim M, Tan YS, Cheng WC, Kingsbury TJ, Heimfeld S, Civin CI. Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164. 10.1111/bjh.13164 PubMed 25312678