Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

RAB14 WT
(Plasmid #61493)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61493 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pWCC43
  • Backbone manufacturer
    a dual promoter lentivector made by the Civin lab
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RAB14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    801
  • GenBank ID
    NM_016322
  • Entrez Gene
    RAB14 (a.k.a. FBP, RAB-14)
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer WCC43-F-seq TTCATTCTCAAGCCTCAGAC
  • 3′ sequencing primer WCC43-R-seq CGGACGCTCGCTGCGCCCTTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    RAB14 WT was a gift from Curt Civin (Addgene plasmid # 61493 ; http://n2t.net/addgene:61493 ; RRID:Addgene_61493)
  • For your References section:

    MIR144 and MIR451 regulate human erythropoiesis via RAB14. Kim M, Tan YS, Cheng WC, Kingsbury TJ, Heimfeld S, Civin CI. Br J Haematol. 2014 Oct 14. doi: 10.1111/bjh.13164. 10.1111/bjh.13164 PubMed 25312678