Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pSkunk3-BLA
(Plasmid #61531)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61531 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDIM-C8-BLA
  • Total vector size (bp) 4361
  • Modifications to backbone
    The coding sequence of the Cm resistance gene was replaced with the streptomycin/spectinomycin (Sm/Spec) resistance gene
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    JM109
  • Growth instructions
    CJ236 is recommended for use in experiments. Please see the publication for details.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    aadA
  • Promoter lacI

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer Amp-F (AAGCCCTCCCGTATCGTAGT)
  • 3′ sequencing primer aadA1-F (agccgaagtttccaaaaggt)
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSkunk3-BLA was a gift from Marc Ostermeier (Addgene plasmid # 61531 ; http://n2t.net/addgene:61531 ; RRID:Addgene_61531)
  • For your References section:

    PFunkel: efficient, expansive, user-defined mutagenesis. Firnberg E, Ostermeier M. PLoS One. 2012;7(12):e52031. doi: 10.1371/journal.pone.0052031. Epub 2012 Dec 17. 10.1371/journal.pone.0052031 PubMed 23284860