pSkunk3-BLA
(Plasmid
#61531)
-
PurposePhagemid expressing streptomycin/spectinomycin resistance gene
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDIM-C8-BLA
- Total vector size (bp) 4361
-
Modifications to backboneThe coding sequence of the Cm resistance gene was replaced with the streptomycin/spectinomycin (Sm/Spec) resistance gene
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Growth instructionsCJ236 is recommended for use in experiments. Please see the publication for details.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameaadA
- Promoter lacI
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Amp-F (AAGCCCTCCCGTATCGTAGT)
- 3′ sequencing primer aadA1-F (agccgaagtttccaaaaggt) (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSkunk3-BLA was a gift from Marc Ostermeier (Addgene plasmid # 61531 ; http://n2t.net/addgene:61531 ; RRID:Addgene_61531) -
For your References section:
PFunkel: efficient, expansive, user-defined mutagenesis. Firnberg E, Ostermeier M. PLoS One. 2012;7(12):e52031. doi: 10.1371/journal.pone.0052031. Epub 2012 Dec 17. 10.1371/journal.pone.0052031 PubMed 23284860
Map uploaded by the depositor.
