-
PurposeTarget a Flp and Cre-dependent tdTomato expression cassette to the mouse Rosa26 locus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61577 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneRosa26 Targeting Vector
- Backbone size w/o insert (bp) 2881
- Total vector size (bp) 16295
-
Vector typeMouse Targeting, Cre/Lox
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Growth instructionsGrow in 15 microg/ml kanamycin
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepCAG-FSF-LSL-tdTomato
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac1 (not destroyed)
- 3′ cloning site Cla (not destroyed)
- 5′ sequencing primer TCTTCGCTATTACGCCAGCT
- 3′ sequencing primer AACAGCTATGACCATG
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NOTE: There are some minor discrepancies between the depositor's assembled sequence and Addgene's quality control sequence. The depositing lab has assessed these differences and states that they do no affect function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Ai65(RCFL-tdT) targeting vector was a gift from Hongkui Zeng (Addgene plasmid # 61577 ; http://n2t.net/addgene:61577 ; RRID:Addgene_61577) -
For your References section:
Transgenic mice for intersectional targeting of neural sensors and effectors with high specificity and performance. Madisen L, Garner AR, Shimaoka D, Chuong AS, Klapoetke NC, Li L, van der Bourg A, Niino Y, Egolf L, Monetti C, Gu H, Mills M, Cheng A, Tasic B, Nguyen TN, Sunkin SM, Benucci A, Nagy A, Miyawaki A, Helmchen F, Empson RM, Knopfel T, Boyden ES, Reid RC, Carandini M, Zeng H. Neuron. 2015 Mar 4;85(5):942-58. doi: 10.1016/j.neuron.2015.02.022. 10.1016/j.neuron.2015.02.022 PubMed 25741722