-
PurposeExpresses human USP21 (USP domain) in E. coli.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61585 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepOPINS
-
Backbone manufacturerOPPF-UK
- Backbone size w/o insert (bp) 5906
- Total vector size (bp) 6684
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUSP21 (Ubiquitin carboxyl-terminal hydrolase 21)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1110
-
MutationDeleted aa 1-195.
-
GenBank IDNM_012475.4
-
Entrez GeneUSP21 (a.k.a. USP16, USP23)
- Promoter T7
-
Tag
/ Fusion Protein
- His6-SUMO (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (destroyed during cloning)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer CGGAAGACCTGGATATGGAAGAC
- 3′ sequencing primer T7 Terminal (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mevissen et al Cell. 2013 Jul 3;154(1):169-84. doi: 10.1016/j.cell.2013.05.046.
Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINS-USP21 (USP, aa 196-565) was a gift from David Komander (Addgene plasmid # 61585 ; http://n2t.net/addgene:61585 ; RRID:Addgene_61585) -
For your References section:
Polyubiquitin binding and cross-reactivity in the USP domain deubiquitinase USP21. Ye Y, Akutsu M, Reyes-Turcu F, Enchev RI, Wilkinson KD, Komander D. EMBO Rep. 2011 Apr;12(4):350-7. doi: 10.1038/embor.2011.17. Epub 2011 Mar 11. 10.1038/embor.2011.17 PubMed 21399617