Skip to main content
Addgene

pOPINS-USP21 (USP, aa 196-565)
(Plasmid #61585)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61585 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pOPINS
  • Backbone manufacturer
    OPPF-UK
  • Backbone size w/o insert (bp) 5906
  • Total vector size (bp) 6684
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    USP21 (Ubiquitin carboxyl-terminal hydrolase 21)
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1110
  • Mutation
    Deleted aa 1-195.
  • GenBank ID
    NM_012475.4
  • Entrez Gene
    USP21 (a.k.a. USP16, USP23)
  • Promoter T7
  • Tag / Fusion Protein
    • His6-SUMO (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (destroyed during cloning)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGGAAGACCTGGATATGGAAGAC
  • 3′ sequencing primer T7 Terminal
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mevissen et al Cell. 2013 Jul 3;154(1):169-84. doi: 10.1016/j.cell.2013.05.046.

Hospenthal MK, Mevissen TET, Komander D. Nature Protoc. 2015 Jan 29;10:349-361. doi:10.1038/nprot.2015.018

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOPINS-USP21 (USP, aa 196-565) was a gift from David Komander (Addgene plasmid # 61585 ; http://n2t.net/addgene:61585 ; RRID:Addgene_61585)
  • For your References section:

    Polyubiquitin binding and cross-reactivity in the USP domain deubiquitinase USP21. Ye Y, Akutsu M, Reyes-Turcu F, Enchev RI, Wilkinson KD, Komander D. EMBO Rep. 2011 Apr;12(4):350-7. doi: 10.1038/embor.2011.17. Epub 2011 Mar 11. 10.1038/embor.2011.17 PubMed 21399617