Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pPdiso4E-ISH
(Plasmid #61701)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61701 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHellsGate12
  • Total vector size (bp) 17681
  • Vector type
    RNAi
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    PdeIF(iso)4E
  • Species
    Plum
  • Insert Size (bp)
    322
  • Promoter 35S

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CTTCGCAAGACCTTCCTCT
  • 3′ sequencing primer TGGTGGAAACTTGCTCGGCT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pPdiso4E-ISH was a gift from Lining Tian (Addgene plasmid # 61701 ; http://n2t.net/addgene:61701 ; RRID:Addgene_61701)
  • For your References section:

    Silencing of the host factor eIF(iso)4E gene confers plum pox virus resistance in plum. Wang X, Kohalmi SE, Svircev A, Wang A, Sanfacon H, Tian L. PLoS One. 2013;8(1):e50627. doi: 10.1371/journal.pone.0050627. Epub 2013 Jan 28. PONE-D-12-26441 [pii] PubMed 23382802