Skip to main content
Addgene

PRK5-FLAG-USP13/5-2
(Plasmid #61744)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61744 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRK5
  • Backbone size w/o insert (bp) 5204
  • Total vector size (bp) 7762
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    USP13/5-2 chimera
  • Species
    H. sapiens (human); USP13/5-2 chimera
  • Insert Size (bp)
    2559
  • Mutation
    USP5 (1-409aa) fused to USP13 (421-864aa)
  • GenBank ID
    NM_003481.2 NM_003940.2
  • Entrez Gene
    USP5 (a.k.a. ISOT)
  • Entrez Gene
    USP13 (a.k.a. ISOT3, IsoT-3)
  • Promoter CMV
  • Tag / Fusion Protein
    • FLAG (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CTCTAGCATTTAGGTGAC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PRK5-FLAG-USP13/5-2 was a gift from Yihong Ye (Addgene plasmid # 61744 ; http://n2t.net/addgene:61744 ; RRID:Addgene_61744)
  • For your References section:

    USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410