pet42c(+)-GST-USP13
(Plasmid
#61749)
-
Purposeexpress N-terminally GST tagged human USP13
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61749 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonePET42C(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5930
- Total vector size (bp) 8522
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameUSP13
-
Alt nameubiquitin carboxyl-terminal hydrolase 13
-
Alt nameISOT3; IsoT-3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2592
-
GenBank IDNM_003940.2
-
Entrez GeneUSP13 (a.k.a. ISOT3, IsoT-3)
- Promoter T7
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pet42c(+)-GST-USP13 was a gift from Yihong Ye (Addgene plasmid # 61749 ; http://n2t.net/addgene:61749 ; RRID:Addgene_61749) -
For your References section:
USP13 antagonizes gp78 to maintain functionality of a chaperone in ER-associated degradation. Liu Y, Soetandyo N, Lee JG, Liu L, Xu Y, Clemons WM Jr, Ye Y. Elife. 2014;3:e01369. doi: 10.7554/eLife.01369. Epub 2014 Jan 14. 10.7554/eLife.01369 PubMed 24424410