pSNAPf-AP
(Plasmid
#61830)
-
PurposeEncodes SNAP-AP fusion for tagging endogenous target for SNAP-SiMPull
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61830 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepAG32
-
Backbone manufacturerEuroscarf
- Backbone size w/o insert (bp) 4160
- Total vector size (bp) 4781
-
Vector typeBacterial Expression, Yeast Expression ; PCR template
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSNAP-AP
-
Alt nameSNAP-SiMPull tag
-
Alt namein vivo biotinylated SNAP tag
-
Alt nameSNAPf-ecAP
-
Insert Size (bp)609
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer Sp6-primer: 5' ATTTAGGTGACACTATAG 3'
- 3′ sequencing primer 5' GACACATGCAGCTCCCGGAGACGGTC 3' (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSNAPf-AP was a gift from Aaron Hoskins (Addgene plasmid # 61830 ; http://n2t.net/addgene:61830 ; RRID:Addgene_61830) -
For your References section:
Rapid isolation and single-molecule analysis of ribonucleoproteins from cell lysate by SNAP-SiMPull. Rodgers ML, Paulson J, Hoskins AA. RNA. 2015 May;21(5):1031-41. doi: 10.1261/rna.047845.114. Epub 2015 Mar 24. 10.1261/rna.047845.114 PubMed 25805862
Map uploaded by the depositor.
